Protein

View in Explore
Genbank accession
AAQ92753.1 [GenBank]
Protein name
tail protein Pb4
RBP type
TSP
Evidence RBPdetect
Probability 0,89
Protein sequence
MISNNAPAKMVLNSVLTGYTLAYIQHSIYSDYDVIGRSFWLKEGSNVTRRDFTGIDTFSVTINNLKPTTTYEVQGAFYDSIIDSELLNAQIGINLSDKQTFKMKSAPRITGARCESEPVDVGVGAPIVYIDTTGEADYCTIELKDNSNANNPWVKYYVGALMPTIMFGGVPIGSYKVRISGQISLPDGVTIDSSGYYEYPNVFEVRYNFVPPAAPINIVFKAARIADGKERYDLRVQWDWNRGAGANVREFVLSYIDSAEFVRTGWTKAQKINVGAAQSATIISFPWKVEHKFKVSSIAWGPDAQDVTDSAVQTFILNESTPLDNSFVNETGIEVNYAYIKGKIKDGSTWKQTFLIDAATGAINIGLLDAEGKAPISFDPVKKIVNVDGSVITKTINAANFVMTNLTGQDNPAIYTQGKTWGDTKSGIWMGMDNVTAKPKLDIGNATQYIRYDGNILRISSEVVIGTPNGDIDIQTGIQGKQTVFIYIIGTSLPAKPTSPAYPPSGWSKTPPNRTSNTQNIYCSTGTLDPVTNQLVSGTSWSDVVQWSGTEGVDGRPGATGQRGPGMYSLAIANLTAWNDSQANSFFTSNFGSGPVKYDVLTEYKSGAPGTAFTRQWNGSAWTSPAMVLHGDMIVNGTVTASKIVANNAFLSQIGVNIIYDRAAALSSNPEGSYKMKIDLQNGYIHIR
Physico‐chemical
properties
protein length:688 AA
molecular weight: 74790,23460 Da
isoelectric point:5,64118
aromaticity:0,10320
hydropathy:-0,19724

Domains

Domains [InterPro]
IPR057550
STR
10–97
IPR057550 IPR057551 IPR057552 IPR057549
IPR057551
STR
104–196
IPR057551
AAQ92753.1
1 688
Architecture
STR
STR
STR
STR
STR 10-97 | STR 103-197 | STR 211-335 | STR 350-667 |
Legend: ATT STR RBD CBM LEC ENZ CHP LNK TAS TTP UNK Unmapped

Tail Spike Domain Segmentation

Tail Spike Domain Segmentation

This protein has been segmented into three structural domains: N-terminal, central domain, and C-terminal.

Domain Layout
N-terminal
Central
C-terminal
AAQ92753.1
1 688
Domain Start End Length (AA) Confidence
N-terminal 1 410 410 0,8680
Central domain 411 653 244 0,1450
C-terminal 654 688 34 0,9097
Legend: N-terminal Central domain C-terminal
3D Structure with Domain Coloring

The structure is colored according to the domain segmentation: N-terminal (blue), Central (green), C-terminal (pink).

Domain Coloring
N-terminal
1-410
Central
411-653
C-terminal
654-688

Taxonomy

  Name Taxonomy ID Lineage
Phage Escherichia phage T5
[NCBI] 		2695836 Uroviricota > Caudoviricetes > Demerecviridae > Tequintavirus > Tequintavirus T5
Host Escherichia coli
[NCBI] 		562 cellular organisms > Bacteria > Pseudomonadati > Pseudomonadota > Gammaproteobacteria > Enterobacterales

Coding sequence (CDS)

Coding sequence (CDS)
Genbank protein accession
AAQ92753.1 [NCBI]
Genbank nucleotide accession
AY543070 [NCBI]
CDS location
range 86484 -> 88550
strand -
CDS
ATGATTTCAAATAATGCACCAGCTAAAATGGTTCTAAATAGCGTCTTAACTGGATATACGTTGGCGTATATCCAGCATTCTATCTACTCTGATTACGACGTTATAGGTAGATCATTTTGGCTTAAAGAAGGCAGCAACGTTACTCGTAGGGATTTCACGGGTATTGATACTTTCTCTGTAACTATTAATAACTTAAAACCTACAACAACTTATGAAGTTCAGGGTGCATTTTATGATTCCATAATAGACTCTGAACTTCTTAATGCACAGATAGGAATTAATCTATCTGATAAGCAAACTTTTAAAATGAAATCAGCACCTAGAATCACTGGTGCTCGATGCGAGTCAGAACCAGTAGATGTTGGTGTTGGAGCACCAATAGTTTATATAGATACTACAGGGGAGGCCGATTATTGCACTATAGAATTAAAAGATAATTCTAATGCCAATAATCCATGGGTTAAATATTACGTTGGTGCACTAATGCCTACTATTATGTTTGGTGGTGTGCCAATTGGATCCTATAAGGTAAGAATTTCTGGTCAAATAAGCCTACCAGACGGTGTTACTATTGATTCATCAGGATACTATGAATATCCTAATGTCTTTGAAGTTAGATATAACTTTGTACCTCCTGCGGCTCCTATTAATATTGTGTTTAAAGCTGCGCGCATAGCAGACGGTAAAGAGCGTTATGATTTACGTGTGCAGTGGGACTGGAATAGGGGTGCGGGTGCTAATGTTCGTGAGTTCGTTCTATCTTATATAGATTCGGCAGAGTTTGTAAGAACTGGATGGACTAAGGCACAAAAAATCAACGTGGGGGCTGCTCAGTCGGCAACAATTATATCATTCCCGTGGAAAGTAGAGCATAAATTTAAAGTGTCATCTATTGCCTGGGGACCAGATGCTCAAGATGTTACTGATTCCGCAGTACAGACATTTATATTAAATGAGAGTACACCATTAGACAATAGTTTTGTTAATGAAACTGGTATCGAAGTAAACTATGCGTACATTAAGGGTAAAATTAAAGATGGATCTACCTGGAAACAAACTTTCTTAATTGACGCTGCAACTGGTGCTATTAATATAGGTCTTCTAGACGCAGAAGGAAAAGCACCAATATCCTTTGACCCTGTTAAAAAGATAGTTAACGTTGATGGGAGTGTAATAACTAAAACTATTAATGCTGCTAACTTTGTCATGACTAATTTAACCGGTCAAGATAACCCAGCAATTTATACACAGGGTAAAACTTGGGGCGATACAAAATCCGGTATCTGGATGGGCATGGATAATGTTACTGCTAAACCAAAATTAGATATTGGTAATGCTACACAGTATATTCGTTATGATGGTAATATACTTAGGATCTCTAGTGAGGTTGTAATTGGTACCCCAAATGGTGATATTGATATACAGACGGGTATACAAGGGAAGCAAACAGTATTTATCTATATTATAGGTACTTCATTACCTGCTAAACCAACAAGTCCTGCATACCCACCTTCTGGTTGGTCTAAAACTCCACCAAATAGAACATCTAATACTCAGAATATTTACTGTTCTACAGGTACTCTGGACCCAGTTACTAATCAATTAGTATCGGGAACTAGTTGGTCTGACGTAGTTCAATGGAGTGGTACAGAAGGTGTTGATGGCAGGCCGGGGGCTACAGGACAACGTGGTCCTGGAATGTATTCTCTTGCTATTGCTAATTTAACAGCATGGAATGACTCACAAGCTAATTCATTTTTTACATCTAATTTCGGCAGTGGTCCTGTTAAATATGACGTATTAACTGAATATAAGAGTGGTGCTCCTGGGACAGCTTTTACTAGACAGTGGAATGGTTCGGCGTGGACTAGCCCTGCAATGGTTTTACACGGAGATATGATAGTTAATGGCACGGTAACTGCTAGTAAAATTGTTGCTAACAATGCTTTCTTATCACAAATTGGTGTAAATATTATATATGATCGTGCAGCAGCACTATCCTCTAACCCAGAGGGATCCTACAAAATGAAGATAGACCTGCAAAACGGGTATATCCATATAAGGTAA

Genome Context

Genome Context

Tertiary structure

1 / 5
PDB ID
Source
Method
Resolution
Oligomeric State

Literature

Title Authors Date PMID Source
Virus-induced acquisition of metabolic function. IV. Thymidylate synthetase in thymine-requiring Escherichia coli infected by T2 and T5 bacteriophages BARNER,H.D. and COHEN,S.S. 1959 13796860 GenBank
Virus-induced acquisition of metabolic function. VI. Dihydrofolate reductase, a new phage-induced enzyme Methews,C.K. and Cohen,S.S. 1963 — GenBank
THE ENZYMOLOGY OF VIRUS-INFECTED BACTERIA. VI. PURIFICATION AND PROPERTIES OF THE DEOXYNUCLEOTIDE KINASE INDUCED BY BACTERIOPHAGE T5 BESSMAN,M.J., HERRIOTT,S.T. and ORR,M.J. 1965 14253449 GenBank
The structural gene for deoxyribonucleic acid polymerase in bacteriophages T4 and T5 De Waard,A., Paul,A.V. and Lehman,I.R. 1965 5219829 GenBank
The enzymology of virus-infected bacteria. VII. A new deoxyribonucleic acid polymerase induced by bacteriophage T5 Orr,C.W., Herriott,S.T. and Bessman,M.J. 1965 5846986 GenBank
Functions of two genes in the first-step-transfer DNA of bacteriophage T5 Lanni,Y. 1969 4897799 GenBank
Patterns of protein synthesis in Escherichia coli infected by amber mutants in the first-step-transfer DNA of T5 McCorquodale,D.J. and Lanni,Y.T. 1970 4915289 GenBank
The deoxyribonuclease induced after infection of Escherichia coli by bacteriophage T5. I. Characterization of the enzyme as a 5'-exonuclease Frenkel,G.D. and Richardson,C.C. 1971 4327330 GenBank
The deoxyribonuclease induced after infection of Escherichia coli by bacteriophage T5. II. Role of the enzyme in replication of the pahge deoxyribonucleic acid Frenkel,G.D. and Richardson,C.C. 1971 4934992 GenBank
Pre-early proteins of bacteriophage T5: structure and function Beckman,L.D., Hoffman,M.S. and McCorquodale,D.J. 1971 5136582 GenBank
Genetic and physiological studies of bacteriophage T5. 3. Patterns of deoxyribonucleic acid synthesis induced by mutants of T5 and the identification of genes influencing the appearance of phage-induced dihydrofolate reductase and deoxyribonuclease Hendrickson,H.E. and McCorquodale,D.J. 1972 4556511 GenBank
Structural proteins of bacteriophage T5 Zweig,M. and Cummings,D.J. 1973 4571380 GenBank
Bacteriophage-induced ribonucleotide reductase systems. T5- and T6-specific ribonucleotide reductase and thioredoxin Eriksson,S. and Berglund,O. 1974 4152788 GenBank
Early events after infection of Escherichia coli by bacteriophage T5. Induction of a 5'-nucleotidase activity and excretion of free bases Warner,H.R., Drong,R.F. and Berget,S.M. 1975 163355 GenBank
In vivo repair of bacteriophage t5 DNA: an assay for viral growth control Herman,R.C. and Moyer,R.W. 1975 1098275 GenBank
Early events after infection of Escherichia coli by bacteriophage T5. II. Control of the bacteriophage-induced 5'-nucleotidase activity Berget,S.M., Mozer,T.J. and Warner,H.R. 1976 176472 GenBank
Characterization of DNA polymerase induced by bacteriophage T5 with DNA containing single strand breaks Fujimura,R.K. and Roop,B.C. 1976 773933 GenBank
Electron micrographs of nicked DNA replicated by T5 DNA polymerase Fujimura,R.K. and Allison,D.P. 1976 1270429 GenBank
Identification of the gene controlling the synthesis of the major bacteriophage T5 membrane protein Duckworth,D.H., Dunn,G.B. and McCorquodale,D.J. 1976 775127 GenBank
Exonuclease associated with bacteriophage T5-Induced DNA polymerase Das,S.K. and Fujimura,R.K. 1976 10451 GenBank
Temperature-sensitive DNA polymerase induced by a bacteriophage T5 mutant: relationship between polymerase and exonuclease activities Fujimura,R.K. and Roop,B.C. 1976 974066 GenBank
Pre-early polypeptides of bacteriophages T5 and BF23 McCorquodale,D.J., Shaw,A.R., Shaw,P.K. and Chinnadurai,G. 1977 325230 GenBank
Properties of deoxynucleoside 5'-monophosphatase induced by bacteriophage T5 after infection of Escherichia coli Mozer,T.J. and Warner,H.R. 1977 21305 GenBank
Isolation and characterization of a bacteriophage T5 mutant deficient in deoxynucleoside 5'-monophosphatase activity Mozer,T.J., Thompson,R.B., Berget,S.M. and Warner,H.R. 1977 335083 GenBank
Mechanism of T5-induced DNA polymerase. I. Replication of short primer templates Das,S.K. and Fujimura,R.K. 1977 336621 GenBank
Mechanism of T5-induced DNA polymerase. II. Characterization of the dead-end complex Das,S.K. and Fujimura,R.K. 1977 411791 GenBank
Gene D5 product of bacteriophage T5: DNA-binding protein affecting DNA replication and late gene expression McCorquodale,D.J., Gossling,J., Benzinger,R., Chesney,R., Lawhorne,L. and Moyer,R.W. 1979 219226 GenBank
Processiveness of DNA polymerases. A comparative study using a simple procedure Das,S.K. and Fujimura,R.K. 1979 368069 GenBank
The purification and properties of a double-stranded DNA-binding protein encoded by the gene D5 of bacteriophage T5 Rice,A.C., Ficht,T.A., Holladay,L.A. and Moyer,R.W. 1979 224043 GenBank
The properties of a bacteriophage T5 mutant unable to induce deoxyuridine 5'-triphosphate nucleotidohydrolase. Synthesis of uracil-containing T5 deoxyribonucleic acid Warner,H.R., Thompson,R.B., Mozer,T.J. and Duncan,B.K. 1979 381286 GenBank
Mechanism of 3' to 5' exonuclease associated with phage T5-induced DNA polymerase: processiveness and template specificity Das,S.K. and Fujimura,R.K. 1980 6255449 GenBank
Mechanism of primer-template-dependent conversion of dNTP leads to dNMP by T5 DNA polymerase Das,S.K. and Fujimura,R.K. 1980 6248549 GenBank
Replication of linear duplex DNA in vitro with bacteriophage T5 DNA polymerase Fujimura,R.K., Das,S.K., Allison,D.P. and Roop,B.C. 1981 7280264 GenBank
Second-step transfer of bacteriophage T5 DNA: purification and characterization of the T5 gene A2 protein Snyder,C.E. Jr. and Benzinger,R.H. 1981 7288924 GenBank
Cloning of bacteriophage T5 DNA fragments. III. Expression in Escherichia coli mini-cells Brunel,F., Davison,J., Ha-Thi,V. and Reeve,J. 1981 6282684 GenBank
Modification of RNA polymerase from Escherichia coli by pre-early gene products of bacteriophage T5 McCorquodale,D.J., Chen,C.W., Joseph,M.K. and Woychik,R. 1981 7033565 GenBank
The nucleotide sequence of bacteriophage T5 RNAI Kryukov,V.M., Shlyapnikov,M.G., Kazantsev,S.I., Kaliman,A.V., Ksenzenko,V.N. and Bayev,A.A. 1982 — GenBank
Cloning of genes for bacteriophage T5 stable RNAs Ksenzenko,V.N., Kamynina,T.P., Kazantsev,S.I., Shlyapnikov,M.G., Kryukov,V.M. and Bayev,A.A. 1982 6285979 GenBank
Interaction of a DNA-binding protein, the gene product of D5 of bacteriophage T5, with double-stranded DNA. Analysis by metrizamide gradient centrifugation Fujimura,R.K. and Roop,B.C. 1982 6294081 GenBank
Interaction of a DNA-binding protein, the product of gene D5 of bacteriophage T5, with double-stranded DNA: effects on T5 DNA polymerase functions in vitro Fujimura,R.K. and Roop,B.C. 1983 6304341 GenBank
Cloning and DNA sequence of the genes for two bacteriophage T5 tRNAsSer Kryukov,V.M., Ksenzenko,V.N., Kaliman,A.V. and Bayev,A.A. 1983 6552980 GenBank
O antigen-dependent mutant of bacteriophage T5 Heller,K.J. and Bryniok,D. 1984 6361278 GenBank
The nucleotide sequence of bacteriophage T5 glutamine transfer RNA Shlyapnikov,M.G., Kaliman,A.V., Kazantsev,S.I., Kryukov,V.M. and Bayev,A.A. 1984 6733112 GenBank
Identification of the phage gene for host receptor specificity by analyzing hybrid phages of T5 and BF23 Heller,K.J. 1984 6093378 GenBank
Bacteriophage T5 gene A2 protein alters the outer membrane of Escherichia coli Snyder,C.E. Jr. 1984 6389511 GenBank
Physical locus of the DNA polymerase gene and genetic maps of bacteriophage T5 mutants Fujimura,R.K., Tavtigian,S.V., Choy,T.L. and Roop,B.C. 1985 2982033 GenBank
Isolation and partial characterization of a bacteriophage T5 mutant unable to induce thymidylate synthetase and its use in studying the effect of uracil incorporation into DNA on early gene expression Swart,W.J. Jr. and Warner,H.R. 1985 3973984 GenBank
Irreversible binding to the receptor of bacteriophages T5 and BF23 does not occur with the tip of the tail Heller,K.J. and Schwarz,H. 1985 3886629 GenBank
Identification by immunobinding assay of the polypeptide coded by the DNA polymerase gene of bacteriophage T5 and its amber mutants and the direction of transcription of the gene Schneider,S.S., Roop,B.C. and Fujimura,R.K. 1985 3897573 GenBank
The nucleotide sequence of bacteriophage T5 leucine tRNA Shlyapnikov,M.G., Kazantsev,S.I., Kryukov,V.M. and Bayev,A.A. 1985 3905432 GenBank
DNA filter retention assay for exonuclease activities. Application to the analysis of processivity of phage T5 induced 5'-exonuclease Joannes,M., Saucier,J.M. and Jacquemin-Sablon,A. 1985 3004572 GenBank
Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5 Kaliman,A.V., Krutilina,A.I., Kryukov,V.M. and Bayev,A.A. 1986 3002857 GenBank
Cell-free transcription and translation of isolated restriction fragments localize bacteriophage T5 pre-early genes Blaisdell,P.W. and Warner,H.R. 1986 3951019 GenBank
Nucleotide sequence of the bacteriophage T5 DNA fragment which contains the gene for tRNAAsp Shlyapnikov,M.G., Ksenzenko,V.N., Kryukov,V.M. and Bayev,A.A. 1986 3516691 GenBank
Structure of two promoters and a terminator of transcription from the region of bacteriophage T5 early genes D10-D15 Kaliman,A.V., Krutilina,A.I. and Kryukov,V.M. 1987 — GenBank
Location of genes D16, D17, and N4 encoding tail proteins on the physical map of bacteriophage T5 Krauel,V. and Heller,K.J. 1987 2958389 GenBank
[Primary structure of tRNAAsn of bacteriophage T5] Shliapnikov,M.G., Kriukov,V.M. and Baev,A.A. 1987 3649233 GenBank
[Primary structure of proline tRNA of bacteriophage T5] Shliapnikov,M.G., Kaliman,A.V., Kriukov,V.M. and Baev,A.A. 1987 3649234 GenBank
Nucleotide sequence of the bacteriophage T5 DNA fragment containing a distal part of tRNA gene region Ksenzenko,V.N., Shlyapnikov,M.G., Azbarov,V.G., Garcia,O., Kryukov,V.M. and Bayev,A.A. 1987 3299272 GenBank
The nucleotide sequence of bacteriophage T5 DNA at the region between early and late genes Kaliman,A.V., Kryukov,V.M. and Bayev,A.A. 1988 3267228 GenBank
The nucleotide sequence of the region of bacteriophage T5 early genes D10-D15 Kaliman,A.V., Kryukov,V.M. and Bayev,A.A. 1988 3057441 GenBank
T5 DNA polymerase: structural--functional relationships to other DNA polymerases Leavitt,M.C. and Ito,J. 1989 2660138 GenBank
Two early genes of bacteriophage T5 encode proteins containing an NTP-binding sequence motif and probably involved in DNA replication, recombination and repair Blinov,V.M., Koonin,E.V., Gorbalenya,A.E., Kaliman,A.V. and Kryukov,V.M. 1989 2547651 GenBank
Properties of overexpressed phage T5 D15 exonuclease. Similarities with Escherichia coli DNA polymerase I 5'-3' exonuclease Sayers,J.R. and Eckstein,F. 1990 2211703 GenBank
Amino acid sequence of the bacteriophage T5 gene A2 protein Snyder,C.E. Jr. 1991 2059212 GenBank
Cloning and overexpression of the gene encoding bacteriophage T5 DNA polymerase Chatterjee,D.K., Fujimura,R.K., Campbell,J.H. and Gerard,G.F. 1991 1995424 GenBank
A single-strand specific endonuclease activity copurifies with overexpressed T5 D15 exonuclease Sayers,J.R. and Eckstein,F. 1991 1651477 GenBank
Nucleotide sequence of the phage T5 DNA segment containing six tRNA genes Ksenzenko,V.N., Wilkens,K., Rueger,W. and Shlyapnikov,M.G. 1992 1461745 GenBank
Structure peculiarities of transfer RNAs coded by bacteriophage T5 Shlyapnikov,M.G. and Ksenzenko,V.N. 1994 — GenBank
Lytic conversion of Escherichia coli by bacteriophage T5: blocking of the FhuA receptor protein by a lipoprotein expressed early during infection Decker,K., Krauel,V., Meesmann,A. and Heller,K.J. 1994 8057856 GenBank
Inactivation of FhuA at the cell surface of Escherichia coli K-12 by a phage T5 lipoprotein at the periplasmic face of the outer membrane Braun,V., Killmann,H. and Herrmann,C. 1994 8045901 GenBank
[Features of the structure of transfer RNA coded by bacteriophage T5] Shliapnikov,M.G. and Ksenzenko,V.N. 1994 7533890 GenBank
The nucleotide sequence of the bacteriophage T5 ltf gene Kaliman,A.V., Kulshin,V.E., Shlyapnikov,M.G., Ksenzenko,V.N. and Kryukov,V.M. 1995 7789514 GenBank
Overproduced and purified receptor binding protein pb5 of bacteriophage T5 binds to the T5 receptor protein FhuA Mondigler,M., Vogele,R.T. and Heller,K.J. 1995 7649453 GenBank
Identification of the bacteriophage T5 dUTPase by protein sequence comparisons Kaliman,A.V. 1996 8988373 GenBank
Identification of the receptor-binding regions of pb5 proteins of bacteriophages T5 and BF23 Mondigler,M., Holz,T. and Heller,K.J. 1996 8623528 GenBank
A helical arch allowing single-stranded DNA to thread through T5 5'-exonuclease Ceska,T.A., Sayers,J.R., Stier,G. and Suck,D. 6586 8657312 GenBank
Structure-specific DNA binding by bacteriophage T5 5'-->3' exonuclease Garforth,S.J. and Sayers,J.R. 1997 9380501 GenBank
Prokaryotic 5'-3' exonucleases share a common core structure with gamma-delta resolvase Artymiuk,P.J., Ceska,T.A., Suck,D. and Sayers,J.R. 1997 9336450 GenBank
[Amber-suppressive tRNA from bacteriophage T5: construction of genes and determination of the effectiveness of suppression in vivo] Pan'kova,N.V., Karamyshev,A.L., Shliapnikov,M.G., Presich,A.N. and Ksenzenko,V.N. 1998 9929878 GenBank
Inactivation in vitro of the Escherichia coli outer membrane protein FhuA by a phage T5-encoded lipoprotein Pedruzzi,I., Rosenbusch,J.P. and Locher,K.P. 1998 9812372 GenBank
Mutagenesis of conserved lysine residues in bacteriophage T5 5'-3' exonuclease suggests separate mechanisms of endo-and exonucleolytic cleavage Garforth,S.J., Ceska,T.A., Suck,D. and Sayers,J.R. 1999 9874768 GenBank
A single cleavage assay for T5 5'-->3' exonuclease: determination of the catalytic parameters forwild-type and mutant proteins Pickering,T.J., Garforth,S.J., Thorpe,S.J., Sayers,J.R. and Grasby,J.A. 1999 9889266 GenBank
Variation in the steady state kinetic parameters of wild type and mutant T5 5'-3'-exonuclease with pH. Protonation of Lys-83 is critical for DNA binding Pickering,T.J., Garforth,S., Sayers,J.R. and Grasby,J.A. 1999 10364212 GenBank
Unusually wide co-factor tolerance in a metalloenzyme; divalent metal ions modulate endo-exonuclease activity in T5 exonuclease Garforth,S.J., Patel,D., Feng,M. and Sayers,J.R. 2001 11433022 GenBank
Characterization of a high-affinity complex between the bacterial outer membrane protein FhuA and the phage T5 protein pb5 Plancon,L., Janmot,C., le Maire,M., Desmadril,M., Bonhivers,M., Letellier,L. and Boulanger,P. 2002 12051859 GenBank
Purification and characterization of the deoxynucleoside monophosphate kinase of bacteriophage T5 Mikoulinskaia,G.V., Gubanov,S.I., Zimin,A.A., Kolesnikov,I.V., Feofanov,S.A. and Miroshnikov,A.I. 2003 12597877 GenBank
An intramolecular disulphide bond reduces the efficacy of a lipoprotein plasma membrane sorting signal Robichon,C., Bonhivers,M. and Pugsley,A.P. 2003 12890035 GenBank
Identification, cloning, and expression of bacteriophage T5 dnk gene encoding a broad specificity deoxyribonucleoside monophosphate kinase (EC 2.7.4.13) Mikoulinskaia,G.V., Zimin,A.A., Feofanov,S.A. and Miroshnikov,A.I. 2004 14711503 GenBank
Characterization of the bacteriophage T5 site-specific endonucleases F-TflV and F-TflVI Akulenko,N.V., Shaloiko,L.A., Shlyapnikov,M.G., Krutilina,A.I. and Ksenzenko,V.N. 2004-07 — GenBank
Identification of genes encoding bacteriophage T5 terminase and portal protein Kaliman,A.V., Ganichkin,O.M., Vasiliev,V.D. and Ksenzenko,V.N. 1996-01 — GenBank
Identification and characterization of novel site-specific endonucleases F-TflI, F-TflII and F-TflIV encoded by the bacteriophage T5 Ksenzenko,V.N., Akulenko,N.V., Kaliman,A.V., Kanapin,A.A., Shestakova,N.M., Shaloiko,L.A., Krutilina,A.I., Ivashina,T.V. and Shlyapnikov,M.G. 2004-07 — GenBank
Identification and characterization of bacteriophage T5 lysis genes Mikoulinskaia,G.V. and Zimin,A.A. 2015-01-19 — GenBank